Systems

This is a skeleton to list items to be detailed in the near future.

FreeDOS and Linux

FreeDOS is available from http://www.freedos.org/.

FreeDOS is an open source DOS-compatible operating system that you can use to play classic DOS games, run legacy business software, or develop embedded systems. Any program that works on MS-DOS should also run on FreeDOS.

It is notable that v1.3 provides liveCD and liteUSB which could be useful.

Here describes how to convert VMDK format to iso, https://www.ilovefreesoftware.com/26/featured/how-to-convert-vmdk-to-iso-in-windows.html, e.g.,

qemu-img convert -f vmdk FD13LITE.VMDK pd.raw
dd if=pd.raw of=pd.iso

We can then use rufus, https://rufus.ie/, to generate a bootable USB allowing for disk partition by fdisk -- in fact rufus itself can produce a bootable USB nevertheless with no utilities.

This is useful to install Linux on very old computers, e.g., reorganise hard drive and then install Fedora from a liveUSB generated from Fedora Media Writer, https://getfedora.org/en/workstation/download/.

There are multiple routes to install particular Linux software; one may prefer to install them as standable but it may also come handy use mini-environments such as Anaconda, Miniconda, Linuxbrew or those already in system (e.g. Ubuntu) archive.

A rich source of tips are in the-art-of-command-line and awesome-shell.

The following command gives bit information (32 or 64)

getconf LONG_BIT

The LSB (Linux Standard Base) and distribution information is given with

lsb_release -a

Under Ubuntu, this could be made available with sudo apt-get install lsb-core.

Under Fedora, you may be prompted to install package redhat-lsb-core. Related commands are uname -a and lscpu.

The CPU speed can be seen with 

 watch -n.1 "cat /proc/cpuinfo | grep \"^[c]pu MHz\""

The screen utility is operated as follows,

screen -S <my-screen-session>
screen -ls
screen -r <my-screen-session-id>

An introduction to Linux Access Control Lists (ACLs), https://www.redhat.com/sysadmin/linux-access-control-lists.

To enable color with nano, try

find /usr/share/nano/ -iname "*.nanorc" -exec echo include {} \; >> ~/.nanorc

Fedora

This has already been covered above, i.e., https://getfedora.org/workstation/download/.

Ubuntu

Releases are available from http://releases.ubuntu.com and packages are listed at https://packages.ubuntu.com/.

Often it is helpful to run

sudo apt update
sudo apt upgrade

to be in line with the current release; one can check for updates with sudo apt list --upgradable.

To resize a virtual disk, follow steps here, https://blog.surges.eu/virtualbox-how-to-solve-the-issue-with-low-disk-space/.

The nautilus desktop can be reset with

sudo apt install gnome-tweak-tool
gnome-tweaks
nautilus-desktop

The Unity desktop can be installed with

sudo apt-get install unity-session
sudo dpkg-reconfigure lightdm

Non-root installation may be necessary, e.g.,

apt download gir1.2-webkit-3.0
apt -i gir1.2-webkit-3.0_2.4.11-3ubuntu3_amd64.deb --force-not-root --root=$HOME

Alternatively, we use source package, typically

apt-get source package
cd package
./configure --prefix=$HOME
make
make install

To unpack a package, one can do

dpkg -x package.deb dir

When a package URL is available, we can use wget, ar x, xz -d, tar xvf combination to do so.

Its archive, http://archive.ubuntu.com/ubuntu/pool/universe, includes beagle, eigensoft, plink, plink-1.9, among others, which can be installed canonically with sudo apt install.

sudo apt-get install libcanberra-gtk3-module

It is useful to use sudo apt install tasksel, then one can use sudo tasksel.

One would get error message such as "You must put some ‘source’ URIs in your sources.list" which can be done as follows

sudo apt-get update
sudo nano /etc/apt/sources.list
# uncomment deb-src here
apt-get source hello

The system hibernation can be done with sudo systemctl hibernate.

Some operations on gnome extensions are given below,

sudo apt install gnome-shell-extensions
sudo apt search gnome-shell-extension
gnome-shell --help
sudo apt install gnome-shell-extension-prefs
# https://extensions.gnome.org/extension/307/dash-to-dock/
sudo gnome-extensions install dash-to-dockmicxgx.gmail.com.v71.shell-extension.zip
sudo apt install gnome-tweaks

Installation of dash-to-dock from GitHub proceeds as follows,

git clone https://github.com/micheleg/dash-to-dock
sudo apt install gettext
make -C dash-to-dock install

Note that gnome-tweak-tool used earlier on has been updated to gnome-tweaks, which removes gnome shell extensions support from version 40 and it is possible with gnome-shell-extension-prefs. Then the Extension apps enables 'dash-on-dock' as with user themes and Glassy/Glassy-dark through gnome-tweaks by unpacking the relevant files to /usr/share/themes. For WhiteSur, various operations are given below,

# https://www.gnome-look.org/p/1403328/
# https://github.com/vinceliuice/WhiteSur-gtk-theme
mkdir ~/.themes
mkdir ~/.icons
tar fvzx WhiteSur-gtk-theme-2022-02-21.tar.gz
cd WhiteSur-gtk-theme-2022-02-21/
./install.sh -s 220
sudo apt install dbus-x11
./tweaks.sh -d
tar xfz WhiteSur-icon-theme-2022-03-18.tar.gz 
cd WhiteSur-icon-theme-2022-03-18/
/install.sh
cd ~/.icons
# https://github.com/vinceliuice/WhiteSur-icon-theme
# https://www.gnome-look.org/p/1405756/
tar xf 01-WhiteSur.tar.xz
sudo apt install dconf-editor
dconf-editor &
gsettings set org.gnome.shell.extensions.dash-to-dock extend-height false
gsettings set org.gnome.shell.extensions.dash-to-dock dock-position BOTTOM
gsettings set org.gnome.shell.extensions.dash-to-dock transparency-mode FIXED
gsettings set org.gnome.shell.extensions.dash-to-dock dash-max-icon-size 64
gsettings set org.gnome.shell.extensions.dash-to-dock unity-backlit-items true

from dconf-editor, follow navigation "org > gnome > shell > extensions > dash-to-dock" to customise, see here.

Finally, perhaps more appealing is the gnome extension dash-to-panel.

Here is information on file sharing, https://www.c-sharpcorner.com/article/how-to-share-files-between-ubuntu-and-windows-10/

Oracle VirtualBox

7.1.4

This requires Visual Studio C++ 2.19, which can be downloaded, e.g. https://aka.ms/vs/17/release/vc_redist.x64.exe.

Windows 7

To use VirtualBox under Windows 7, one needs to enable virtualisation within security section of BIOS setup. To find out system info, one can run

systeminfo

A useful tip is from https://blog.csdn.net/xz360717118/article/details/67638548

Failed to instantiate CLSID_VirtualBox w/ IVirtualBox, but CLSID_VirtualBox w/ IUnknown works.
2017年03月28日 16:50:30 一只猪儿虫 阅读数 17551 标签： virtualbox win7 更多
个人分类： 服务器
版权声明：本文为博主原创文章，未经博主允许不得转载。 https://blog.csdn.net/xz360717118/article/details/67638548

我是 win7 64位

解决办法：

1， win+r 快捷键打开 “运行”，输入regedit 打开注册表


2，找到 HKEY_CLASSES_ROOT\CLSID\{00020420-0000-0000-C000-000000000046}
InprocServer32 修改 第一行（默认）的值为 C:\Windows\system32\oleaut32.dll


3，找到HKEY_CLASSES_ROOT\CLSID\{00020424-0000-0000-C000-000000000046}
InprocServer32  修改 第一行（默认）的值为 C:\Windows\system32\oleaut32.dll

4，完事。（我修改了完了 也没试用，直接重启电脑 然后成功了）

Actually, there is no need to reboot Windows at Step 4.

It is possible that installation of Ubuntu could be freezed, in which case a proposal was to proceed with disabling 3D Acceleration and increasing the number of CPUs to 2-4, see https://www.maketecheasier.com/fix-ubuntu-freezing-virtualbox/.

However, our experiment showed that one can enable 3D Acceleration and two CPUs for installation but it is necessary to disable 3D Acceleration and reset CPU to be one for a system with one CPU after installation. The system informatino can be obtained with systeminfo command as described above.

Fedora & shared folders

The guest additions under Fedora 28 is furnished with

sudo dnf update
sudo dnf install gcc kernel-devel kernel-headers dkms make bzip2 perl
cd /run/media/jhz22/VBox_GAs_5.2.12/
sudo ./VBoxLinuxAdditions.run

To set up shared folders and enforce shared clipboard for bidirectional copy between Linux and Windows,

# shared folders
sudo mount -t vboxsf -o uid=jhz22 C /home/jhz22/C
sudo mount -t vboxsf -o uid=jhz22 D /home/jhz22/D
# shared clipboard
killall VBoxClient
sudo VBoxClient-all

Another attempt is through VBoxMange, e.g., VBoxManage.exe sharedfolder add "22.04" --name U --hostpath "U:\".

For Fedora 31, see https://www.if-not-true-then-false.com/2010/install-virtualbox-guest-additions-on-fedora-centos-red-hat-rhel/.

See https://www.nakivo.com/blog/make-virtualbox-full-screen/ on full-screen size, in particular,

"\Program Files\Oracle\VirtualBox\VBoxManage" setextradata "32" VBoxInternal2/EfiGraphicsResolution 1920x1080 for virtual machine 32.

Compression

Here are the steps, quoting http://www.netreliant.com/news/8/17/Compacting-VirtualBox-Disk-Images-Linux-Guests.html, for compressing large .vdi:

# Linux
dd if=/dev/zero of=zerofillfile bs=1M

rem Windows
path D:\Program Files\Oracle\VirtualBox
VBoxManage modifyhd --compact "ubuntu18.04.vdi"

OVA file

This is useful, e.g., Windows 11 development environment.

Import the OVA file into Oracle VirtualBox:

  • Open Oracle VirtualBox.
  • Select FileImport Appliance.
  • Click Folder to browse to the directory where the OVA file was downloaded.
  • Select the Okta Access Gateway OVA file, and then click Open.
  • Click Next.

See https://help.okta.com/oag/en-us/content/topics/access-gateway/deploy-ovb.htm.

Windows 11

Official site

From the official ISO location, https://aka.ms/DownloadWindows11, select "Download Windows 11 Disk Image (ISO) for x64 devices.".

Verify your download after download, https://www.microsoft.com/en-us/software-download/windows11, from Windows PowerShell,

Get-FileHash D:\Downloads\Win11_23H2_EnglishInternational_x64v2.iso

Algorithm       Hash                                                                   Path
---------       ----                                                                   ----
SHA256          705AC061688FFD7F5721DA844D01DF85433856EAFAA8441ECE94B270685CA2DB       D:\Downloads\Win11_23H2_EnglishInternational_x64v2.iso

and also

Get-FileHash D:\Downloads\Win11_24H2_EnglishInternational_x64.iso
Algorithm       Hash                                                                   Path
---------       ----                                                                   ----
SHA256          D5A4C97C3E835C43B1B9A31933327C001766CE314608BA912F2FFFC876044309       D:\Downloads\Win11_24H2_EnglishInternational_x64.iso

as listed here, https://learn.microsoft.com/en-us/powershell/module/microsoft.powershell.utility/?view=powershell-7.4.

Hash values for the ISO files for Each Language

Country Locale Hash Code
Arabic 64-bit 97ED2DF27DEBE5A8E94FB37BE4383EB8516D5C24117793BDA5C1E13568D3F754
Bulgarian 64-bit 1C1BD6E96290521B7E4F814ACA30C2CC4C7FAB1E3076439418673B90954A1FFC
Chinese Simplified 64-bit BD1ECBA89BC59B7B62EF12C88C4E70D456EDAC10B969ECB3299EBD458B1F0FB3
Chinese Traditional 64-bit B92C3D6D428D12CF78A8D287B8FB28FFBC44D4A36B74C1B121C3CF443DC67ED2
Croatian 64-bit 95C7008AB1B0BA65212A36FB728AC93B9D7611400A78393FE7B319ED5B74AC5C
Czech 64-bit 76120E535DB895D0EA69F47D55B836940821352A010DEDFCBCFC1E22E619FC4B
Danish 64-bit D5D34DFFE45BA557581ADA14AC025DB8AA58989D054706061B7D0E5B47F5FDB9
Dutch 64-bit EE9BC545673D8F954A1EDAC691D749438D3E4DFA10A75D2519F79E3708D79FDC
English 64-bit B56B911BF18A2CEAEB3904D87E7C770BDF92D3099599D61AC2497B91BF190B11
English International 64-bit D5A4C97C3E835C43B1B9A31933327C001766CE314608BA912F2FFFC876044309
Estonian 64-bit D12DC03FA15A7F436A800692E9BA30DBDDAA4CD6122DD71719A2898E953B5407
Finnish 64-bit D6057E058021A9DF8A02B7BB16331D88C38E8BB63D5AD897D094E0DF6C6ADB5A
French 64-bit B73AA55DB50D2AD348F61C6537DA05C0D6DED78A143763454E977BE85B444119
French Canadian 64-bit 3CA47351DAD16BD3F7AFA27CDEB321DD726B79859DE8D2769359C7621DE38EC4
German 64-bit 96E036F1219F9EE59F96312CE43EC7DF093E768383A77132750271940926A013
Greek 64-bit 92248F9F5A8735337D4B0DCCE4DD13348F8718858590FD9D1EB00020B5AFB33A
Hebrew 64-bit 27D8090B9266A2DAC04E403FE63E46ADE661A5661BF26CA5EBB1A2F13245E86F
Hungarian 64-bit 7B58807592AEB2FC5DDF5AF9749FA023CE9165AA4A1BF4F4741709F8AA2EE9D3
Italian 64-bit D95EC65EC06B4036835C7571FE0108159848D2883EF5DA3A67E480130B1F5862
Japanese 64-bit A1E1BCB6C014F39E4A324EC24DB1B745EE62617D29A450BF7B2596A3DCCECD7D
Korean 64-bit 63ED86ADFC53F464649478F931EAE39A42DB3FD86C266C9B5AF7F8E19D318C51
Latvian 64-bit F4C2BF7C16576E6D631070D7B7CF6F55E8359D0729B571C570DC6F39D77D9EA6
Lithuanian 64-bit 23B14643B0AD6FDD0231EA201C5E1B000912EE3A0542F1B1F6907DB470AE7D7B
Norwegian 64-bit 6CBD6C3FED9CE08AF85420F19D01C287FC58EC0C42DC7409D1D5C341CEB6492B
Polish 64-bit 654273603A945EBA3B185FD5D2C22207A0EB788B5E3402F71E6D0839B3026943
Brazilian Portuguese 64-bit 1BC63E9C62FE3EB7E46778F24C790933770FA7430304583BBDF96B47A5D61F1F
Portuguese 64-bit FAAFEDFC301A381B0712FC8DB9F0A16ADE2716B998DD4855D0A38172A9A87AB4
Romanian 64-bit 8B23AD43DF35EB75FADDFDFC85D616A001A4D72C757E5286011E3DC9452A5862
Russian 64-bit D0FBDB93864BF6C8ADE844473C9600EBB031C8BB656A272C736E45DFBD9B3BC9
Serbian Latin 64-bit 566047460EEA2F0E0D36E7A378DCFEEA79D7D3C0328227646BE4AB9AC39A9E36
Slovak 64-bit 5B77F2B5F7C77ABF68E628AC37A8841BB1058B7173C1C76DC5A5F6C5BBA855FD
Slovenian 64-bit 73F0DC7CC15885F565C76D78D54E4E4D9934720FFE583B52EFDDA2E2457402D7
Spanish 64-bit 708AF7C9AC63B7EB045CA9B196568758B6C1749E8D13CADE61FAACBC7C66D142
Spanish (Mexico) 64-bit BA7A9B9A2052DEF8C24BCB88C76A47B2E6A6C6EE547EED226B9702C5C63AFC69
Swedish 64-bit F3674D377253E2D12635FDEAB76193E80BD80C56A41D10AB9CCEFDB0CDF1AD82
Thai 64-bit CAD5590347376103E369D7E04941B94C037F4CC6C75D81DC50E194FFA87C8CF8
Turkish 64-bit A47E054FE0B762F5B48D08E2B6F768F4B1CA0BC6DB831A76E829F92E578483AF
Ukrainian 64-bit 68BABB954E4BFDF8A03ABC188D5120CF12D4DCA3CAE68EB1BFD4B64F872826E2

Some changes as from October 2024,

Microsoft Windows [Version 10.0.22631.4249]
(c) Microsoft Corporation. All rights reserved.

C:\Windows\System32>reg.exe delete "HKLM\SOFTWARE\Microsoft\Windows NT\CurrentVersion\AppCompatFlags\CompatMarkers" /f 2>NUL
The operation completed successfully.

C:\Windows\System32>reg.exe delete "HKLM\SOFTWARE\Microsoft\Windows NT\CurrentVersion\AppCompatFlags\Shared" /f 2>NUL
The operation completed successfully.

C:\Windows\System32>reg.exe delete "HKLM\SOFTWARE\Microsoft\Windows NT\CurrentVersion\AppCompatFlags\TargetVersionUpgradeExperienceIndicators" /f 2>NUL
The operation completed successfully.

C:\Windows\System32>reg.exe add "HKLM\SOFTWARE\Microsoft\Windows NT\CurrentVersion\AppCompatFlags\HwReqChk" /f /v HwReqChkVars /t REG_MULTI_SZ /s , /d "SQ_SecureBootCapable=TRUE,SQ_SecureBootEnabled=TRUE,SQ_TpmVersion=2,SQ_RamMB=8192,"
The operation completed successfully.

C:\Windows\System32>
C:\Windows\System32>reg.exe add "HKLM\SYSTEM\Setup\MoSetup" /f /v AllowUpgradesWithUnsupportedTPMOrCPU /t REG_DWORD /d 1
The operation completed successfully.

C:\Windows\System32>

See also ZDNET, https://www.zdnet.com/article/how-to-upgrade-your-incompatible-windows-10-pc-to-windows-11/ & Rufus, https://rufus.ie/en/.

It is reported that the changes above have been implemented in Rufus 4.6.

Build on the fly

git clone https://github.com/AveYo/MediaCreationTool.bat
cd MediaCreationTool.bat
MediaCreationTool.bat

and also https://massgrave.dev/windows_11_links, https://github.com/Raphire/Win11Debloat.

Further information

CloneVDI is described in this thread, https://forums.virtualbox.org/viewtopic.php?f=6&t=22422.

Moreover, https://www.maketecheasier.com/shrink-your-virtualbox-vm/ and http://bytefreaks.net/windows/reclaim-empty-space-from-virtualbox-vdi-disk-images-by-shrinking.

vdi.md as in GWAS-2017 and now listed in GDCT

Since one may allocate only part of RAM to VirtualBox, it is often necessary to run program under MS-DOS, e.g., sections on DEPICT.

Additional note: 6.1.4 has problem with its Guest Additions. To enable copy/paste through clipboard one can use VBoxGuestAdditions_6.1.97-136310.iso as discused here, https://www.virtualbox.org/ticket/19336.

When VirtualBox failed to start a session, one can enter MS-DOS prompt as adminstrator, and issue command bcdedit /set hypervisorlaunchtype off and restart the computer.

When there is error message VirtualBox Failed to open session for Virtual Machine, then right click the machine and Discard Saved state. Otherwise, uninstall VirtualBox and reinstall.

VirtualBox 7.x.x is considerably easier to set up.

SystemRescue

See https://www.system-rescue.org/

Windows Hyper-V

Web page: https://docs.microsoft.com/en-us/virtualization/hyper-v-on-windows/quick-start/enable-hyper-v

Enable Hyper-V to create virtual machines on Windows 10.

Hyper-V can be enabled in many ways including using the Windows 10 control panel, PowerShell or using the Deployment Imaging Servicing and Management tool (DISM). This documents walks through each option:

Control Panel --> Programs --> Programs and Features --> Turn Windows Features on or off: Hyper-V, Virtual Machine Platforms.

WSL

Official page: https://github.com/microsoft/WSL

To check version of Windows, issue winver (MS-DOS Prompt: Windows + r, cmd, winver).

Installation and setup

A description on PowerShell is here, https://learn.microsoft.com/en-us/windows/wsl/install. To initiate from PowerShell, use

dism /online /enable-feature /feature-name:Microsoft-Windows-Subsystem-Linux /all /norestart
dism /online /enable-feature /featurename:VirtualMachinePlatform /all /norestart

After installation, it can be invoked from a MS-DOS Prompt with

wsl -help
wsl --list
wsl --list --online
wsl --list --verbose
wsl --distribution Ubuntu
wsl --set-default Ubuntu-20.04

The command could also takes additional parameters, e.g., -d debian. One can also create a desktop entry pointing to C:\Windows\system32\wsl.exe.

Location of the distros are found by

cd %LocalAppData%\Packages\
cd CanonicalGroupLimited.UbuntuonWindows_79rhkp1fndgsc

For old Windoes build, there is complaint about writing BIOS then an update called wsl_update_x64.msi is required. A comparison of WSL 1 and WSL 2 can be seen from https://aka.ms/wsl2 (https://learn.microsoft.com/en-us/windows/wsl/compare-versions).

To migrate from WSL 1 to WSL 2, several options are possible,

# A distribution only
wsl --set-version Ubuntu 2
wsl --set-version Ubuntu-20.04 2
# WSL as a whole
wsl --set-default-version 2

and return with error messages,

Conversion in progress, this may take a few minutes...

For information on key differences with WSL 2 please visit https://aka.ms/wsl2
The requested operation could not be completed due to a virtual disk system limitation.  Virtual hard disk files must be uncompressed 
and unencrypted and must not be sparse.

To fix this, as in https://logfetch.com/wsl2-uncompressed/, open up File Explorer and navigate to:

C:\Users\YOUR_USER\AppData\Local\Packages\CanonicalGroupLimited...

Right click on LocalState, then Properties, then Advanced.

Ensure Compress contents to save disk space and Encrypt contents to secure data are both deselected.

Click OK, then Apply, then Apply changes to this folder only

Software mobaXterm, https://mobaxterm.mobatek.net/ offers Advanced WSL settings, Graphical environments such as Gnome-desktop/LDXE-desktop/XFCE4-desktop so as to create sessions using graphical desktops. The corresponding installations are ubuntu-gnome-desktop (gnome-session-bin), lubuntu-desktop, xubuntu-desktop (in fact xfce4-session, xubuntu-core, xubuntu-default-settings), respectively.

After started, create a session for WSL, open it and install software.

sudo apt update
sudo apt install nautilus
sudo apt install firefox

etc. By default C:\ is /mnt/c. To establish other drives, one can do

sudo mkdir /mnt/d
sudo mount -t drvfs D: /mnt/d
sudo umount /mnt/d

The network drive can also be mapped, e.g.,

sudo mkdir /mnt/u
sudo mount -t drvfs '\\me-filer1.medschl.cam.ac.uk\home$\jhz22' /mnt/u
sudo mount -t drvfs U: /mnt/u

See https://www.cyberciti.biz/faq/ubuntu-linux-install-gnome-desktop-on-server/.

See also https://www.makeuseof.com/tag/linux-desktop-windows-subsystem/.

ubuntu-wsl is a set of WSL utilities, which could be installed with

sudo apt install ubuntu-wsl

for executables at /usr/bin, e.g., wslvar PATH for Windows' \%PATH environment variable and wslsys for basic information, wslusc to create a short cut on Windows desktop.

GUI apps

This is available from https://learn.microsoft.com/en-us/windows/wsl/tutorials/gui-apps.

Example applications include gedit, gimp, nautilus, vlc, x11-apps, microsoft-edge (https://www.microsoftedgeinsider.com/en-us/download?platform=linux-deb).

In case of problems, try Intel® Driver & Support Assistant (Intel® DSA), https://www.intel.co.uk/content/www/uk/en/support/detect.html.

These files are described https://ubuntu.com/tutorials/install-ubuntu-on-wsl2-on-windows-11-with-gui-support#1-overview showing octave:

We start with octave --gui and open scripts julia.m and juliatest.m, select run and then save file and run for figure julia.png, julia.png.

The flowblade GUI is available with sudo apt-get install flowblade. After installation, one can start with

export PYTHONPATH=/usr/share/flowblade/Flowblade:/usr/share/flowblade/Flowblade/vieweditor/:/usr/share/flowblade/Flowblade/tools
export SHORTCUTS_PATH=/usr/share/flowblade/Flowblade/res
/usr/bin/flowblade

or cd /bin;./flowblade, https://github.com/jliljebl/flowblade/issues/857.

xfce4 & rdp

xfce4 can also be made available with

sudo apt update
sudo apt install xorg
sudo apt install xfce4
echo xfce4-session > ~/.xsession
xfce4-session &

or work with xrdp:

sudo apt install xrdp
sudo cp /etc/xrdp/xrdp.ini /etc/xrdp/xrdp.ini.bak
sudo sed -i 's/port=3389/port=3390/' /etc/xrdp/xrdp.ini
sudo /etc/init.d/xrdp restart

One can add line sudo service xrdp start to ~/.bashrc. Moreover from a start up directory such as %UserProfile%, create a file named .wslconfig with lines such as

processors=4
memory=4GB
swap=4GB
localhostForwarding=true

The remote desktop can be started from DOS Prompt mstsc for localhost:3390 (127.0.0.1:3390). Programs such as FireFox can be started.

To avoid running the service from every terminal session, amend the service xrdp as follows,

export plus=$(service --status-all 2>&1 | grep xrdp | cut -d' ' -f3)
if [[ "$plus" != "+" ]]; then
   echo $plus
   sudo service xrdp start
fi

Earlier note: We use check IPv4 address from Windows as follows with systeminfo (or ipconfig) and start rdp to <IPv4 address>:3390.

To avoid a dark screen, select Applications --> Settings --> Light Locker Settings --> Automatically lock the screen --> Never, Apply.

One may also execute wsl --shutdown to reninitialize.

Compression of disk

wsl --shutdown
diskpart
select vdist file="D:\wsl\Ubuntu-2204\ext4.vhdx"
compact vdisk
echo "%LocalAppData%\Packages\CanonicalGroupLimited.UbuntuonWindows_79rhkp1fndgsc\\LocalState\ext4.vhdx"
select vdisk file="C:\Users\User\AppData\Local\Packages\CanonicalGroupLimited.UbuntuonWindows_79rhkp1fndgsc\LocalState\ext4.vhdx"
compact vdisk

Downloading specific distributions

The list is available from https://learn.microsoft.com/en-us/windows/wsl/install-manual but alternatives are also possible.

# Ubuntu 21.10
wget https://cloud-images.ubuntu.com/releases/impish/release/ubuntu-21.10-server-cloudimg-amd64-wsl.rootfs.tar.gz
mkdir d:\wsl
wsl --import Ubuntu-2110 d:/WSL/Ubuntu-2110 d:/Downloads/ubuntu-21.10-server-cloudimg-amd64-wsl.rootfs.tar.gz
wsl -d Ubuntu-2110
adduser jhz22
usermod -aG sudo jhz22
su jhz22
ln -s /mnt/c C
ln -s /mnt/d D
ln -s /mnt/f F
# restart
wsl -d Ubuntu-2110 -u jhz22
# Ubuntu 22.04
# https://cloud-images.ubuntu.com/releases/22.04/release-20220923/ubuntu-22.04-server-cloudimg-arm64-wsl.rootfs.tar.gz

Windows applications

To start firefox or Chrome, here is a simple way,

cmd.exe /c start https://github.com
echo cmd.exe /c start https://github.com > ${HOME}/bin/edge
chmod +x ${HOME}/bin/edge
edge

It is possible with default applications under Windows, e.g., cmd.exe /c u:/work/eQTL-MR.pptx which opens up PowerPoint directly.

One can actually generalize these, e.g.,

ln -s $HOME/C/Program\ Files\ \(x86\)/Adobe/Acrobat\ Reader\ DC/Reader/AcroRd32.exe /home/$USER/bin/AcroRd32.exe
ln -s $HOME/bin/AcroRd32.exe /home/$USER/bin/xpdf

followed by a call to AcroRd32.exe and as xpdf, or directly call a list of programs: calc.exe, comp.exe, control.exe, curl.exe, fc.exe, find.exe, finger.exe, mspaint.exe, net.exe, sort.exe, tar.exe, whoami.exe, write.exe, xcopy.exe.

Uninstallation

This is achieved by

# via wsl
wsl --unregister Ubuntu-20.04
# via wslconfig
wslconfig /u Ubuntu-20.04

Anaconda

Once installed, it is customary to make several channels accessible,

conda config --add channels defaults
conda config --add channels conda-forge
conda config --add channels bioconda

Package in conda-forge include boost, django, glpk, gnuplot, go, gperf, hdf5, ipython, jquery, julia, jupyter, keras, limix, mercurial, miktex, mysql, nano, numpy, pandas, sage, scikit-learn, zlib. Packages in bioconda includes amos, bcftools, beagle, bedops, bedtools, blast, bowtie, bowtie2, bwa, chromhmm, circos, deeptools, emmix, ensembl-vep, fastlmm, fastqc, gatk, gatk4, hclust2, himmer, himmer2, hisat2, igv, impute2, lofreq, mapsplice, mrbayes, ms, nanostat, paml, pbgzip, phylip, picard, plink, plink2, r-wgcna, rsem, rtg-tools, sambamba, samtools, seqkt, sequana, snpeff, snpsift, sra-tools, star, stringtie, tabix, tophat, ucsc-blat, ucsc-liftover, vcftools.

For instance, to install intervaltree as required by depict, the following is sufficience,

conda install intervaltree

All the packages installed can be seen with conda list. To install java, run following command

conda install -c anaconda openjdk

Other installations include perl, R. Note that conda under Windows is in typically D:/ProgramData/Anaconda2/Library/bin. Altogether we really need to

set path=%path%;D:/ProgramData/Anaconda2;D:/ProgramData/Anaconda2/Library/bin

Miniconda is available from https://conda.io/miniconda.html.

Installation from scratch,

wget https://repo.anaconda.com/archive/Anaconda2-2019.03-Linux-ppc64le.sh
sh Anaconda2-2019.03-Linux-ppc64le.sh
# do not activate at startup
conda config --set auto_activate_base false
export PYTHONPATH=/scratch/jhz22/lib/python2.7/site-packages/

Examine .bashrc for changes.

See https://docs.anaconda.com/anaconda/user-guide/getting-started/ to get started.

GitHub

See physalia for information.

It has been suggested to display math using the following premium in a GitHub page,

<script src="https://polyfill.io/v3/polyfill.min.js?features=es6"></script>
<script type="text/javascript" id="MathJax-script" async
  src="https://cdnjs.cloudflare.com/ajax/libs/mathjax/3.0.0/es5/latest?tex-mml-chtml.js">
</script>
<script>window.MathJax = {
  tex: {
    inlineMath: [['$', '$'], ['\\(', '\\)']]
  }
}
</script>

A current repository on GitHub is here, https://cambridge-ceu.github.io/GitHub-matters/.

mercurial

This is associated with the familiar hg command as used for instance by qctool.

It is the executable file for Mercurial source code management system,

sudo apt install mercurial

libraOffice

sudo add-apt-repository ppa:libreoffice/ppa
sudo apt-get update
sudo apt-get install libreoffice

Linuxbrew

Follow http://linuxbrew.sh/ and possibly https://docs.brew.sh

sudo apt-get install build-essential
sh -c "$(curl -fsSL https://raw.githubusercontent.com/Linuxbrew/install/master/install.sh)"
echo 'export PATH="/home/linuxbrew/.linuxbrew/bin:$PATH"' >>~/.profile
echo 'export MANPATH="/home/linuxbrew/.linuxbrew/share/man:$MANPATH"' >>~/.profile
echo 'export INFOPATH="/home/linuxbrew/.linuxbrew/share/info:$INFOPATH"' >>~/.profile
PATH="/home/linuxbrew/.linuxbrew/bin:$PATH"

AWS

http://aws.amazon.com/

The Open Guide to Amazon Web Services.

E.g.,

modules

It is a system that allows you to easily change between different versions of compilers and other software.

Here explains how to set up globally,

# https://www.microbialsystems.cn/en/post/xubuntu_env_modules/

wget http://archive.ubuntu.com/ubuntu/pool/universe/m/modules/modules_5.2.0.orig.tar.xz
xz -d modules_5.2.0.orig.tar.xz
tar xvf modules_5.2.0.orig.tar
cd modules-5.2.0
sudo apt-get install tcl-dev tk-dev
./configure
make
sudo make install
ls /usr/local/Modules
source /usr/local/Modules/init/bash
sudo ln -s /usr/local/Modules/init/profile.sh /etc/profile.d/modules.sh
sudo ln -s /usr/local/Modules/init/profile.csh /etc/profile.d/modules.csh
echo -e "\n# For initiating Modules" | sudo tee -a /etc/bash.bashrc > /dev/null  # Append a line to the end of this file with no return message.
echo ". /etc/profile.d/modules.sh" | sudo tee -a /etc/bash.bashrc > /dev/null
less /usr/local/Modules/init/profile.sh
module avail
module list

Modification can be seen, e.g.,

function module ()
{
    curl -sf -XPOST http://modules-mon.hpc.cam.ac.uk/action -H 'Content-Type: application/json' -d '{ "username":"'$USER'", "hostname":"'$HOSTNAME'", "command":"'"$*"'" }' 2>&1 > /dev/null;
    eval `/usr/bin/modulecmd bash $*`
}

module load matlab/r2014a
matlab $@

Usually the eval line is sufficient.

docker

See https://www.docker.com/ and https://docs.docker.com/

# https://docs.docker.com/engine/install/ubuntu/
for pkg in docker.io docker-doc docker-compose docker-compose-v2 podman-docker containerd runc; do sudo apt-get remove $pkg; done
# Add Docker's official GPG key:
sudo apt-get update
sudo apt-get install ca-certificates curl
sudo install -m 0755 -d /etc/apt/keyrings
sudo curl -fsSL https://download.docker.com/linux/ubuntu/gpg -o /etc/apt/keyrings/docker.asc
sudo chmod a+r /etc/apt/keyrings/docker.asc

# Add the repository to Apt sources:
echo \
  "deb [arch=$(dpkg --print-architecture) signed-by=/etc/apt/keyrings/docker.asc] https://download.docker.com/linux/ubuntu \
  $(. /etc/os-release && echo "$VERSION_CODENAME") stable" | \
  sudo tee /etc/apt/sources.list.d/docker.list > /dev/null
sudo apt-get install docker-ce docker-ce-cli containerd.io docker-buildx-plugin docker-compose-plugin

For instance,

git clone https://docs.docker.com/engine/install/ubuntu/
docker run --rm -it neoaggelos/knotify /knotify/bin/rna_analysis --sequence AAAAAACUAAUAGAGGGGGGACUUAGCGCCCCCCAAACCGUAACCCC

giving

CCCAAACCGUAACCCC
Sequence:  AAAAAACUAAUAGAGGGGGGACUUAGCGCCCCCCAAACCGUAACCCC
Structure: ..............((((((.....[[[))))))....]]]......
Energy: -13.800000190734863
Duration: 0.297946 s

By default, Docker is only accessible with root privileges (sudo). As a regular user, add your user to the docker group.

sudo addgroup --system docker
sudo adduser $USER docker
newgrp docker
sudo snap disable docker
sudo snap enable docker

For Fedora 33, we have

udo dnf -y install dnf-plugins-core
sudo dnf config-manager --add-repo https://download.docker.com/linux/fedora/docker-ce.repo
sudo dnf install docker-ce docker-ce-cli containerd.io
sudo systemctl start docker
sudo docker pull eqtlcatalogue/susie-finemapping:v20.08.1
sudo docker run eqtlcatalogue/susie-finemapping:v20.08.1
# remove docker engine
# sudo dnf remove docker-ce docker-ce-cli containerd.io
# removed all images, containers, and volumes
sudo rm -rf /var/lib/docker

OpenVPN

See https://github.com/OpenVPN/openvpn-gui.

Usage example:

sudo openvpn --config myconfig.vopn

Time Zone

An example under Fedora,

timedatectl list_timezones
timedatectl set-timezone Europe/London

which is useful to synchronise with files obtained from elsewhere.

Web-Linux ssh terminal

ShellinaBox

sudo apt update
sudo apt-get install shellinabox
sudo systemctl enable shellinaboxd
# restart/start/stop
sudo service shellinabox restart
sudo systemctl start shellinaboxd
sudo systemctl restart shellinaboxd
sudo systemctl stop shellinaboxd
# alternatives which work
sudo /etc/init.d/shellinabox start
sudo /etc/init.d/shellinabox stop
/etc/init.d/shellinabox status

so firefox https://127.0.0.1:4200 & allows for login from firefox.

cpolar

Web: https://www.cpolar.com (https://dashboard.cpolar.com/signup, https://dashboard.cpolar.com/login, https://dashboard.cpolar.com/get-started)

sudo apt install curl
curl -L https://www.cpolar.com/static/downloads/install-release-cpolar.sh | sudo bash
cpolar
sudo systemctl enable cpolar
sudo systemctl start cpolar
firefox localhost:9200 &

Don't like your Linux desktop? Here's how to install an alternative, https://www.zdnet.com/article/dont-like-your-linux-desktop-heres-how-to-install-an-alternative/.